si:ch211-149p10.1

Ensembl ID:
ENSDARG00000079570
ZFIN ID:
ZDB-GENE-060503-667
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZD0]
Human Orthologue:
RSPO2
Human Description:
R-spondin 2 homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:28583]
Mouse Orthologue:
Rspo2
Mouse Description:
R-spondin 2 homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1922667]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11926 Nonsense Available for shipment Available now
sa2871 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa11926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109124 Nonsense 15 248 1 5
ENSDART00000131899   None 210 None 4
Genomic Location (Zv9):
Chromosome 16 (position 41218845)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38603645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAGATGCAGTTTCGCCTGTTCTCATTTGCGCTGATTGTGTTGAACTG[T/A]GTGGACTACAGCCACTGTCAGACGCAGCARTCCCACCGCTGGAGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2871
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109124 Nonsense 61 248 2 5
ENSDART00000131899 Nonsense 28 210 1 4
Genomic Location (Zv9):
Chromosome 16 (position 41183359)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38568159
KASP Assay ID:
554-3211.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCTGCTCGGTGTGTTCCAAGGACAACGGGTGYATGAACTGYCAGCCC[A/T]AGCTCTTCCTGTTCCKGAGGAGGGAGAGRATGAGGCAGTACGGCGAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link