LOC566707

Ensembl ID:
ENSDARG00000079569
Human Orthologue:
AMIGO3
Human Description:
adhesion molecule with Ig-like domain 3 [Source:HGNC Symbol;Acc:24075]
Mouse Orthologue:
Amigo3
Mouse Description:
adhesion molecule with Ig like domain 3 Gene [Source:MGI Symbol;Acc:MGI:2444854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37668 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111323 Nonsense 31 461 1 1
Genomic Location (Zv9):
Chromosome 23 (position 19758768)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19543875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCCTCAGGGCTGCTTGTGCACATCTGACATACTGAACTGTGGCTCTT[T/A]GGGTCTGGATAGATTTCCCAACCCGCTTCCGTTCACAACTTCTGTCCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link