LOC100334608

Ensembl ID:
ENSDARG00000079561
Human Orthologue:
OSCP1
Human Description:
organic solute carrier partner 1 [Source:HGNC Symbol;Acc:29971]
Mouse Orthologue:
Oscp1
Mouse Description:
organic solute carrier partner 1 Gene [Source:MGI Symbol;Acc:MGI:1916308]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25450 Nonsense Mutation detected in F1 DNA During 2016
sa44396 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113225 Nonsense 101 381 3 10
ENSDART00000114729 Nonsense 111 391 4 11
Genomic Location:
Chromosome Zv9_scaffold3563 (position 274520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGTCCATTTGTAGCTCTATGATTTGATGACAATGGCGTTCAAGTA[T/G]CAAGTCCTGCTATGTCCTCGTCCTAAAGACATTCTCCTTGTGTCCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113225 Nonsense 148 381 4 10
ENSDART00000114729 Nonsense 158 391 5 11
Genomic Location:
Chromosome Zv9_scaffold3563 (position 274776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTTTAATGTATATTTAAAAATCTTATTCTTAACTCTTAGATATA[T/A]ACCTCTTTATCCGGTGGAGAGTTTCAACTAATTAGACAAACACTGCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link