ptprh

Ensembl ID:
ENSDARG00000079560
ZFIN ID:
ZDB-GENE-091118-90
Description:
SAP-1 [Source:UniProtKB/TrEMBL;Acc:C7U138]
Human Orthologue:
PTPRH
Human Description:
protein tyrosine phosphatase, receptor type, H [Source:HGNC Symbol;Acc:9672]
Mouse Orthologue:
Ptprh
Mouse Description:
protein tyrosine phosphatase, receptor type, H Gene [Source:MGI Symbol;Acc:MGI:3026877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37824 Nonsense Mutation detected in F1 DNA During 2017
sa30043 Nonsense Mutation detected in F1 DNA During 2017
sa44088 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113212   None 217 None 8
ENSDART00000114768 Nonsense 232 984 4 18
ENSDART00000145504 Nonsense 26 779 1 15
Genomic Location (Zv9):
Chromosome 24 (position 7913950)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7771242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAAAGACGAATACACTTATGAGCTGGACAAAAGTGATGCTAATACT[C/T]AAATATCATTTACTGATACTACAGTGGTGTGTCTCATCACATCTTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113212   None 217 None 8
ENSDART00000114768 Nonsense 553 984 8 18
ENSDART00000145504 Nonsense 347 779 5 15
Genomic Location (Zv9):
Chromosome 24 (position 7919785)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7777077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATCTTAAGTGCGAATATCATTCTGGAGGATATGGTCTGGCTGTCATGT[G/A]GGATTATCCAGATGGAGTTGTGGATGTGGTGGAGGTGGATGTTAACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113212 Essential Splice Site 154 217 5 8
ENSDART00000114768 Essential Splice Site 725 984 12 18
ENSDART00000145504 Essential Splice Site 520 779 9 15
Genomic Location (Zv9):
Chromosome 24 (position 7925383)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7782675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTCCCTGAAAACAAGGATAAAAATCGATTCTCCAATGTTTTACCAT[G/T]TGAGTATTTACTTTATATACTAGAAACTTCAAGAAAAGTAAAGGTATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link