LOC100333552

Ensembl ID:
ENSDARG00000079559
Human Orthologue:
FAM196A
Human Description:
family with sequence similarity 196, member A [Source:HGNC Symbol;Acc:33859]
Mouse Orthologue:
Fam196a
Mouse Description:
family with sequence similarity 196, member A Gene [Source:MGI Symbol;Acc:MGI:3605068]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115373 Nonsense 60 483 1 3
Genomic Location:
Chromosome 12 (position 44827110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGCCCTTCAGGTGCGTTTCAAGGACATCTGTGAGGCACAGAATGAA[C/T]AGGCAGCTGCTGCCCGGGGAGGAAAGCCGGTCTACAAAGTGGCRTACCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tf96h2xl