ccdc85cb

Ensembl ID:
ENSDARG00000079555
ZFIN ID:
ZDB-GENE-040718-373
Description:
Coiled-coil domain-containing protein 85C-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DHL7]
Human Orthologue:
CCDC85C
Human Description:
coiled-coil domain containing 85C [Source:HGNC Symbol;Acc:35459]
Mouse Orthologue:
Ccdc85c
Mouse Description:
coiled-coil domain containing 85C Gene [Source:MGI Symbol;Acc:MGI:3644008]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4099 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114851 Nonsense 105 399 1 7
Genomic Location:
Chromosome 20 (position 5268467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGACCGGCAGAAAGGTAAGAAGCTGTCTCGGGAATGGCAGAGGTTTGGG[A/T]AGTTYACGGCGAGCTCCGTATGGAAGGAGGTGAGCACCTATCAGCAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gvk3nptq