tnfsf18

Ensembl ID:
ENSDARG00000079550
ZFIN ID:
ZDB-GENE-101109-1
Description:
tumor necrosis factor (ligand) superfamily, member 18 [Source:RefSeq peptide;Acc:NP_001122290]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20131 Nonsense Available for shipment Available now
sa44577 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112615 Nonsense 76 202 2 3
Genomic Location (Zv9):
Chromosome 3 (position 48473444)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50474584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTCTGTCCCAACAGGGTTCGGAAACAACCAGTAATAATGTTTA[T/A]CCTGGAAAGAAAATAGATCTAATGACATTCACGCCAAACTGTAAGTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112615 Nonsense 145 202 3 3
Genomic Location (Zv9):
Chromosome 3 (position 48472359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCCTTGACTCGAGGAAAAAAGAAAACCACACAATCACAGTCCAAACA[C/T]AAAAACAAAATGTGATCTTAAAAGGTTACATCAATGGATCAAACCTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link