tnfsf18

Ensembl ID:
ENSDARG00000079550
ZFIN ID:
ZDB-GENE-101109-1
Description:
tumor necrosis factor (ligand) superfamily, member 18 [Source:RefSeq peptide;Acc:NP_001122290]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20131 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112615 Nonsense 76 202 2 3
Genomic Location:
Chromosome 3 (position 48473444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTCTGTCCCAACAGGGTTCGGAAACAACCAGTAATAATGTTTA[T/A]CCTGGAAAGAAAATAGATCTAATGACATTCACGCCAAACTGTAAGTCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/36g5tdl1