dpys

Ensembl ID:
ENSDARG00000079543
ZFIN ID:
ZDB-GENE-070508-1
Description:
dihydropyrimidinase [Source:RefSeq peptide;Acc:NP_001116535]
Human Orthologue:
DPYS
Human Description:
dihydropyrimidinase [Source:HGNC Symbol;Acc:3013]
Mouse Orthologue:
Dpys
Mouse Description:
dihydropyrimidinase Gene [Source:MGI Symbol;Acc:MGI:1928679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10595 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114795 Essential Splice Site 261 500 4 9
Genomic Location (Zv9):
Chromosome 16 (position 47150574)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44349364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGAGCAAATCTGCAGCGAAGGTGGTGGCTAATGCACGCAGAAATGG[T/G]AAGACTAAAGCACAAATAACACTCTTAGAATAGAAGAGTTATTTTATCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link