LOC100331903

Ensembl ID:
ENSDARG00000079530
Human Orthologue:
SPAG9
Human Description:
sperm associated antigen 9 [Source:HGNC Symbol;Acc:14524]
Mouse Orthologue:
Spag9
Mouse Description:
sperm associated antigen 9 Gene [Source:MGI Symbol;Acc:MGI:1918084]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11313 Nonsense Available for shipment Available now
sa3945 Nonsense Mutation detected in F1 DNA During 2014
sa2860 Essential Splice Site F2 line generated During 2014
sa5621 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa11313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108581 Nonsense 1049 1272 40 45
Genomic Location:
Chromosome 16 (position 19737376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCTTTGGGTGGGATACTGGAATAAAGTTTAYATGATCAGTRCAAAA[C/T]AAYGAAAAATACAGGTTGGTCTTAAAAGGACATGGTGTTGTTCATTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108581 Nonsense 1050 1272 40 45
Genomic Location:
Chromosome 16 (position 19737373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTGGGTGGGATACTGGAATAAAGTTTAYATGATCAGTRCAAAACAA[C/T]GAAAAATACAGGTTGGTCTTAAAAGGACATGGTGTTGTTCATTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2860
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108581 Essential Splice Site 1110 1272 41 45
ENSDART00000108581 Essential Splice Site 1110 1272 41 45
Genomic Location:
Chromosome 16 (position 19737104)
KASP Assay ID:
554-3054.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCCACTACAGGAAGTAGATTTATCATCCATGGTGACTAAAGCTTTAG[G/A]TATTTGGACTGGACTGTATTCTTTTATTTTTTGTATAGATTTTTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5621
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108581 Essential Splice Site 1110 1272 41 45
ENSDART00000108581 Essential Splice Site 1110 1272 41 45
Genomic Location:
Chromosome 16 (position 19737104)
KASP Assay ID:
554-3054.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCCACTACAGGAAGTAGATTTATCATCCATGGTGACTAAAGCTTTAG[G/A]TATTTGGACTGGACTGTATTCTTTTATTTTTTGTATAGATTTTTATTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dwnihfjg