si:ch211-69e5.1

Ensembl ID:
ENSDARG00000079519
ZFIN ID:
ZDB-GENE-090313-130
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JI71]
Human Orthologues:
CRB1, CRB2, DNER, JAG1, JAG2
Human Descriptions:
crumbs homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2343]
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
delta/notch-like EGF repeat containing [Source:HGNC Symbol;Acc:24456]
jagged 1 [Source:HGNC Symbol;Acc:6188]
jagged 2 [Source:HGNC Symbol;Acc:6189]
Mouse Orthologues:
Crb1, Crb2, Dner, Jag1, Jag2
Mouse Descriptions:
crumbs homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2136343]
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]
delta/notch-like EGF-related receptor Gene [Source:MGI Symbol;Acc:MGI:2152889]
jagged 1 Gene [Source:MGI Symbol;Acc:MGI:1095416]
jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42268 Nonsense Mutation detected in F1 DNA During 2017
sa17288 Essential Splice Site Available for shipment Available now
sa35566 Nonsense Mutation detected in F1 DNA During 2017
sa22361 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504   None 573 None 12
ENSDART00000140645 Nonsense 44 217 2 5
Genomic Location (Zv9):
Chromosome 13 (position 38436576)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37913388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTCAGAACACGCCGTCTGTGTGGACCAACAGCACAACTACACCTG[T/A]CGCTGCATGCTGGGATATGAGGGAACGCTCTGTGAGCTTGAGACAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Essential Splice Site 44 573 None 12
ENSDART00000140645 Essential Splice Site 90 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38436438)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37913250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGATTTGGTGGCAGGATACCAATGCCTGTGTGCACCAGGATTTAAGGG[T/G]AAGTCAAATGTTTTATTTAGAAGWGTTAACGTGGGCGGGGAAACTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Nonsense 230 573 5 12
ENSDART00000140645   None 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38388931)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37865743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATGGAGCGTCCTGCTCAGATGAGCTTAACTCCTTCAGCTGTCTCTG[C/A]CTTGCCGGCACTACAGGTACACAATTCCTTCCTGCAGAGTTTCAAGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Nonsense 429 573 10 12
ENSDART00000140645   None 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38349432)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37826244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCATTTGCATTTCAGAGTTACAACTGCCTCTGTCTACCCGGATGG[G/T]AGGGGGAGTACTGTCAAAGGGAGACCAATGAATGTTTATCAAACCCCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link