ENSDARG00000079514

Ensembl ID:
ENSDARG00000079514
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20308 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111016 Nonsense 78 714 1 4
Genomic Location:
Chromosome 4 (position 44248206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCATCTACTGCTTTAGTTGTCGAATTTTTCTGAGAGAAGAAAAATTC[A/T]AAAACAAAACAGCCTGGAAGACATTAGGCATAAATACATGGAGGAGCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fro5zxag