B0JZP1_DANRE

Ensembl ID:
ENSDARG00000079512
Description:
LOC569234 protein [Source:UniProtKB/TrEMBL;Acc:B0JZP1]
Human Orthologue:
FAM193B
Human Description:
family with sequence similarity 193, member B [Source:HGNC Symbol;Acc:25524]
Mouse Orthologue:
Fam193b
Mouse Description:
family with sequence similarity 193, member B Gene [Source:MGI Symbol;Acc:MGI:2385851]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6355 Nonsense Mutation detected in F1 DNA During 2017
sa12202 Nonsense Available for shipment Available now
sa44814 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125891 Nonsense 79 658 2 12
ENSDART00000130530 Nonsense 57 922 2 10
Genomic Location (Zv9):
Chromosome 14 (position 47541884)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44826212
KASP Assay ID:
554-4175.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGATGTGTTTGCTKTGTGTCTCTCTGCAGTCSATGCACAYCTGTTG[T/A]CTGCTGTGCCACCGTGAGTTTAAGGACTGGGGGTCYGGCGGGGCAAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125891 Nonsense 174 658 3 12
ENSDART00000130530 Nonsense 152 922 3 10
Genomic Location (Zv9):
Chromosome 14 (position 47545915)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44822181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCWGTATGTGTTGTCCCGCAGGTGCCGCTGTCCCACTCGTCCTCATG[T/A]AAGTCTCAGAGYTGTGGGAACGGTWATCCGGAGAACAGTTCGGTGGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125891 Essential Splice Site 575 658 7 12
ENSDART00000130530 Essential Splice Site 553 922 7 10
Genomic Location (Zv9):
Chromosome 14 (position 47554160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGCGCCAAGGCGGCAAAGCGGGCACGGCACAAACAGAAGAAGAAGG[T/A]ACGCGGGTCGTTTTTACCTCACTGTGTGTTTAAATATCACAGCTGTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link