B0JZP1_DANRE

Ensembl ID:
ENSDARG00000079512
Description:
LOC569234 protein [Source:UniProtKB/TrEMBL;Acc:B0JZP1]
Human Orthologue:
FAM193B
Human Description:
family with sequence similarity 193, member B [Source:HGNC Symbol;Acc:25524]
Mouse Orthologue:
Fam193b
Mouse Description:
family with sequence similarity 193, member B Gene [Source:MGI Symbol;Acc:MGI:2385851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6355 Nonsense Mutation detected in F1 DNA During 2014
sa12202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125891 Nonsense 79 658 2 12
ENSDART00000130530 Nonsense 57 922 2 10
Genomic Location:
Chromosome 14 (position 47541884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGATGTGTTTGCTKTGTGTCTCTCTGCAGTCSATGCACAYCTGTTG[T/A]CTGCTGTGCCACCGTGAGTTTAAGGACTGGGGGTCYGGCGGGGCAAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125891 Nonsense 174 658 3 12
ENSDART00000130530 Nonsense 152 922 3 10
Genomic Location:
Chromosome 14 (position 47545915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCWGTATGTGTTGTCCCGCAGGTGCCGCTGTCCCACTCGTCCTCATG[T/A]AAGTCTCAGAGYTGTGGGAACGGTWATCCGGAGAACAGTTCGGTGGATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oxw1opj6