mfn2

Ensembl ID:
ENSDARG00000079504
ZFIN ID:
ZDB-GENE-081105-44
Description:
mitofusin-2 [Source:RefSeq peptide;Acc:NP_001121726]
Human Orthologue:
MFN2
Human Description:
mitofusin 2 [Source:HGNC Symbol;Acc:16877]
Mouse Orthologue:
Mfn2
Mouse Description:
mitofusin 2 Gene [Source:MGI Symbol;Acc:MGI:2442230]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13351 Essential Splice Site Available for shipment Available now
hu3528 Nonsense Confirmed mutation in F2 line Unknown
sa21386 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Essential Splice Site 104 757 2 17
ENSDART00000140266 Essential Splice Site 104 757 3 18
Genomic Location:
Chromosome 8 (position 50073442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGKGAAGTCCTGTCCCGAAGACACATGAARGTGGTCTTCTTTGGCAGG[T/C]ACRGTGCATAGATTTTGCCCCTCACAGAATAAACGCAAACATATGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3528
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Nonsense 285 757 7 17
ENSDART00000140266 Nonsense 285 757 8 18
Genomic Location:
Chromosome 8 (position 50087109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTTTTGTCAGGTGAGGCGGCAGCACATGGACCGCTGCACTAGTTTTT[T/A]AGTGGATGAGCTGCGGGTGGTGGATCGCTCTCATGCCGGGGATCGAATCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Nonsense 615 757 14 17
ENSDART00000140266 Nonsense 615 757 15 18
Genomic Location:
Chromosome 8 (position 50099220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTATGGTTTCTATGGTGACAGGACTGGCATCACTCACCTCTCGGACAT[C/A]AATGGGCATCATAGTTGTTGGAGGAGTGGTAAGAACACACTGGATATCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m2vl37wm