si:ch211-149l1.2

Ensembl ID:
ENSDARG00000079501
ZFIN ID:
ZDB-GENE-090313-40
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM07]
Human Orthologue:
C2orf55
Human Description:
chromosome 2 open reading frame 55 [Source:HGNC Symbol;Acc:33454]
Mouse Orthologue:
2010300C02Rik
Mouse Description:
RIKEN cDNA 2010300C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919347]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38293 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19581 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108523 Essential Splice Site 166 832 4 10
ENSDART00000136747   None 134 None 5
ENSDART00000140824 Essential Splice Site 166 775 4 9
Genomic Location (Zv9):
Chromosome 1 (position 50194880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49044061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGGAAACCTACTTGTATGAGCGAGTGATGCATGGAGGCATTTACAAG[G/A]TTGCAGACTTTAACTTTGACCATTTGATTTGATTTGAGTTTAAACAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108523 Splice Site, Nonsense 745 832 9 10
ENSDART00000136747   None 134 None 5
ENSDART00000140824 Splice Site, Nonsense 745 775 9 9
Genomic Location (Zv9):
Chromosome 1 (position 50204416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49053597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAGCTTTGATCCAAAAATATACATTAAAAGGAAATGTATTCTGTTAG[C/T]AGGACAACAGTAGGAACAATACCACCGAAGATGACACGACAAAGAGAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link