kif3c

Ensembl ID:
ENSDARG00000079500
ZFIN ID:
ZDB-GENE-080709-4
Description:
kinesin family member 3C [Source:RefSeq peptide;Acc:NP_001017849]
Human Orthologue:
KIF3C
Human Description:
kinesin family member 3C [Source:HGNC Symbol;Acc:6321]
Mouse Orthologue:
Kif3c
Mouse Description:
kinesin family member 3C Gene [Source:MGI Symbol;Acc:MGI:107979]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23137 Nonsense Available for shipment Available now
sa23136 Nonsense Mutation detected in F1 DNA During 2016
sa36475 Nonsense Mutation detected in F1 DNA During 2016
sa36474 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Nonsense 74 759 1 8
Genomic Location:
Chromosome 17 (position 37381202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAATCCTCCGGAAGCCTCGTCAAATCATTCACGTTTGATGCCGTCTA[T/A]GACGTAAGCTCAAAACAAAACGAGTTGTACGACTATGCATGCAAACCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Nonsense 159 759 1 8
Genomic Location:
Chromosome 17 (position 37380947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCTCAGAACCAGCAGTATCTCGTGAGAGTGTCTTACATTGAGATTTA[T/A]CAAGAAGAGATACGAGATCTCCTCTGCAAGGACAACAACAAAAAACTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Nonsense 393 759 1 8
Genomic Location:
Chromosome 17 (position 37380247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCGCAGCTCGAAGAACGAGGGATGCTGGCGAAAGAAAGAAGACGA[C/T]AGAAGAGAAACAGCCTCAGGATGAAGAGGAGTATGAGTAGCGGAGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Essential Splice Site 556 759 4 8
Genomic Location:
Chromosome 17 (position 37378318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCTTTTTTCTTTCCCCTCGGTCAACCTTGCTTTGGTTGCTCCTCTCA[G/A]TTTTACAGTAAGCTGCAGTTGGTGAGATCTGAGATTGGAGATATCATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link