kif3c

Ensembl ID:
ENSDARG00000079500
ZFIN ID:
ZDB-GENE-080709-4
Description:
kinesin family member 3C [Source:RefSeq peptide;Acc:NP_001017849]
Human Orthologue:
KIF3C
Human Description:
kinesin family member 3C [Source:HGNC Symbol;Acc:6321]
Mouse Orthologue:
Kif3c
Mouse Description:
kinesin family member 3C Gene [Source:MGI Symbol;Acc:MGI:107979]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23137 Nonsense Available for shipment Available now
sa23136 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Nonsense 74 759 1 8
Genomic Location:
Chromosome 17 (position 37381202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAATCCTCCGGAAGCCTCGTCAAATCATTCACGTTTGATGCCGTCTA[T/A]GACGTAAGCTCAAAACAAAACGAGTTGTACGACTATGCATGCAAACCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128715 Nonsense 159 759 1 8
Genomic Location:
Chromosome 17 (position 37380947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCTCAGAACCAGCAGTATCTCGTGAGAGTGTCTTACATTGAGATTTA[T/A]CAAGAAGAGATACGAGATCTCCTCTGCAAGGACAACAACAAAAAACTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w58t6efk