si:ch211-136i24.1

Ensembl ID:
ENSDARG00000079496
ZFIN ID:
ZDB-GENE-081031-9
Description:
Novel protein similar to vertebrate bicaudal D homolog 1 (Drosophila) (BICD1) [Source:UniProtKB/TrEM
Human Orthologue:
BICD1
Human Description:
bicaudal D homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1049]
Mouse Orthologue:
Bicd1
Mouse Description:
bicaudal D homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1101760]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17748 Nonsense Available for shipment Available now
sa16298 Nonsense Available for shipment Available now
sa14781 Nonsense Available for shipment Available now
sa390 Nonsense Available for shipment Available now
sa36586 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112671   222 854 4 8
ENSDART00000140854 Nonsense 222 820 4 7
ENSDART00000112671 Nonsense 222 854 4 8
ENSDART00000140854 Nonsense 222 820 4 7
Genomic Location (Zv9):
Chromosome 18 (position 11553609)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12136539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCTTGAAGAAGAAACGGTGCTGCTCAACAGTCAATTAGAAGAYGCTT[T/A]ACGGTTAAAAGACATTTCCCAAGGCCAGTTGGAGGAAGCGTTGGATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112671   222 854 4 8
ENSDART00000140854 Nonsense 222 820 4 7
ENSDART00000112671 Nonsense 222 854 4 8
ENSDART00000140854 Nonsense 222 820 4 7
Genomic Location (Zv9):
Chromosome 18 (position 11553609)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12136539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCTTGAAGAAGAAACGGTGCTGCTCAACAGTCAATTAGAAGAYGCTT[T/A]ACGGTTAAAAGACATTTCCCAAGGCCAGTTGGAGGAAGCGTTGGATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112671 Nonsense 431 854 5 8
ENSDART00000140854 Nonsense 431 820 5 7
Genomic Location (Zv9):
Chromosome 18 (position 11560011)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12142941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCTGTGAGTTTGARACWGACATCAATGGAATAGAGCTTYTAGAGTGC[A/T]AATACAGAGYTGCCGTGACTGAGGTCATTGACTTGAAGGCGGAGCTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112671 Nonsense 613 854 5 8
ENSDART00000140854 Nonsense 613 820 5 7
Genomic Location (Zv9):
Chromosome 18 (position 11560557)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12143487
KASP Assay ID:
554-0252.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGGAACCCCTTGGAGACGGAATTAAAGGGGAAGGAGGAAGTCCCAAT[A/T]GAACCCCATTTGGCTCACCAATCAATGGTTCATCTCTCTCATCCTCCACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112671 Splice Site, Nonsense 718 854 5 8
ENSDART00000140854 Splice Site, Nonsense 718 820 5 7
Genomic Location (Zv9):
Chromosome 18 (position 11560872)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12143802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAGAGAGCAGATCGCCACCTTACGTCTTGTCCTAAAAGCCAACAAA[C/T]AGGTAGAAGACCAAGTCTTTGCAAGAACTACTTTTAAATTGAGTAATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link