NTAN1

Ensembl ID:
ENSDARG00000079495
Description:
N-terminal asparagine amidase [Source:HGNC Symbol;Acc:29909]
Human Orthologue:
NTAN1
Human Description:
N-terminal asparagine amidase [Source:HGNC Symbol;Acc:29909]
Mouse Orthologue:
Ntan1
Mouse Description:
N-terminal Asn amidase Gene [Source:MGI Symbol;Acc:MGI:108471]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061761 Nonsense 228 279 18 18
ENSDART00000112247 Nonsense 228 279 16 16
Genomic Location (Zv9):
Chromosome 6 (position 1404358)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 926257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGTGATTTTAATATGACTTCACTCGTCTGTTTGTCTCCTCAGTATT[T/A]GTCCACGTCGCCATATGCAGAACCTCCTCATTTTGTGCACCACATTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link