ENSDARG00000079489

Ensembl ID:
ENSDARG00000079489
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39371 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24166 Nonsense Mutation detected in F1 DNA During 2016
sa17640 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112776 Essential Splice Site 243 402 2 5
Genomic Location (Zv9):
Chromosome 22 (position 22846346)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22457982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATTGAAACCTCTCTACAGACACGTAGAGGGAACTCGCCATGTCAAGG[T/C]ACAGTCAATGCAGGTGGTCTTGCACCTTCATGTAATAATTTCCACTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112776 Nonsense 262 402 3 5
Genomic Location (Zv9):
Chromosome 22 (position 22846750)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22458386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAACCACCAAACCAAATTCTCATCTCTGGGTTGAATCAGAATTTTT[C/A]AAACAAGACTTGTGTAACCTTTGACCCTGTAAGTGGGAAACCGATTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112776 Splice Site, Nonsense 295 402 4 5
Genomic Location (Zv9):
Chromosome 22 (position 22848559)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22460195
KASP Assay ID:
2261-6826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTTCTTTTTGKGCTGWAATGCATTCTTGTGTATTTTCATTTCAGTG[C/T]AGCTGGACTTTGATTTTCCAGGGACTTCATTCTTCWCMAAAGTCAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link