ENSDARG00000079489

Ensembl ID:
ENSDARG00000079489
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24166 Nonsense Mutation detected in F1 DNA During 2014
sa17640 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112776 Nonsense 262 402 3 5
Genomic Location:
Chromosome 22 (position 22846750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAACCACCAAACCAAATTCTCATCTCTGGGTTGAATCAGAATTTTT[C/A]AAACAAGACTTGTGTAACCTTTGACCCTGTAAGTGGGAAACCGATTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112776 Splice Site, Nonsense 295 402 4 5
Genomic Location:
Chromosome 22 (position 22848559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTTCTTTTTGKGCTGWAATGCATTCTTGTGTATTTTCATTTCAGTG[C/T]AGCTGGACTTTGATTTTCCAGGGACTTCATTCTTCWCMAAAGTCAGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wy595ypn