fam20a

Ensembl ID:
ENSDARG00000079486
ZFIN ID:
ZDB-GENE-081022-117
Description:
family with sequence similarity 20, member A [Source:RefSeq peptide;Acc:NP_001124252]
Human Orthologue:
FAM20A
Human Description:
family with sequence similarity 20, member A [Source:HGNC Symbol;Acc:23015]
Mouse Orthologue:
Fam20a
Mouse Description:
family with sequence similarity 20, member A Gene [Source:MGI Symbol;Acc:MGI:2388266]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27857 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41932 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112182 Essential Splice Site 110 527 1 11
Genomic Location (Zv9):
Chromosome 12 (position 3531394)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2904914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGGAGCTCATCAACTACTACCAGAGGAAAGTGAGCCGCTGGGAGAGG[T/C]AATACACAGTTGATTTGTTGATGTTTATAGCAGGATTTAAAGGGGTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112182 Nonsense 237 527 5 11
Genomic Location (Zv9):
Chromosome 12 (position 3511948)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2885468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGCACGAAGAGACACCAGAGAACTTCTTTTACTTTGTGGACTTTCAG[A/T]GACATAATGCCGAGATCGCAGCTTTCCATCTCGACAGGTGAGACTTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link