kcnt1

Ensembl ID:
ENSDARG00000079484
Human Orthologue:
KCNT1
Human Description:
potassium channel, subfamily T, member 1 [Source:HGNC Symbol;Acc:18865]
Mouse Orthologue:
Kcnt1
Mouse Description:
potassium channel, subfamily T, member 1 Gene [Source:MGI Symbol;Acc:MGI:1924627]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7948 Nonsense Mutation detected in F1 DNA During 2014
sa23851 Nonsense Mutation detected in F1 DNA During 2014
sa12911 Nonsense Available for shipment Available now
sa4933 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 13 1020 2 24
Genomic Location:
Chromosome 21 (position 5153277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTKTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAGATCTTCTG[G/A]CCTCCTCTCAGAAACCTCTTCATCCCAGTGTTCCTCAACTGCTGGCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 397 1020 11 24
Genomic Location:
Chromosome 21 (position 5139164)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGATTGGTGTGAAGAGAGAAGATAATAAGAGCATCTTGTTGAACCCT[G/T]GACCGCGACACATCATGTCTGCCAGCGACACCTGTTACTACATCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 555 1020 13 24
Genomic Location:
Chromosome 21 (position 5132927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTCCRACCCTTTGCCATCTTTTACCTCAGAAAGCYCCTTTCTGCTG[T/A]TTACGGCTTGACCAGGTRAGCAGTGWTCCTCAAGACATCTAAATATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 931 1020 21 24
Genomic Location:
Chromosome 21 (position 5121357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGAGAGGGAGGAGCTYACTGAACTGGTCAGAAACCGSATGCAGCATT[T/A]AGGCCTGCACACTGGCGGATACAGTAAGCCAYGCTTCTTTCCTMRTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5e7hbg6b