kcnt1

Ensembl ID:
ENSDARG00000079484
Human Orthologue:
KCNT1
Human Description:
potassium channel, subfamily T, member 1 [Source:HGNC Symbol;Acc:18865]
Mouse Orthologue:
Kcnt1
Mouse Description:
potassium channel, subfamily T, member 1 Gene [Source:MGI Symbol;Acc:MGI:1924627]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23851 Nonsense Available for shipment Available now
sa12911 Nonsense Available for shipment Available now
sa29503 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43577 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 397 1020 11 24
Genomic Location (Zv9):
Chromosome 21 (position 5139164)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4735308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGATTGGTGTGAAGAGAGAAGATAATAAGAGCATCTTGTTGAACCCT[G/T]GACCGCGACACATCATGTCTGCCAGCGACACCTGTTACTACATCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Nonsense 555 1020 13 24
Genomic Location (Zv9):
Chromosome 21 (position 5132927)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4729071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTCCRACCCTTTGCCATCTTTTACCTCAGAAAGCYCCTTTCTGCTG[T/A]TTACGGCTTGACCAGGTRAGCAGTGWTCCTCAAGACATCTAAATATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Essential Splice Site 560 1020 13 24
Genomic Location (Zv9):
Chromosome 21 (position 5132911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4729055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCTTTTACCTCAGAAAGCCCCTTTCTGCTGTTTACGGCTTGACCAG[G/A]TGAGCAGTGATCCTCAAGACATCTAAATATTATACCTGCACAATATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113556 Essential Splice Site 772 1020 18 24
Genomic Location (Zv9):
Chromosome 21 (position 5127351)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4723495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGCCGAGTCTTCAGTATCAGCATGCTGGACACACTCCTGTACCAG[G/A]TAAATGCGTGTCTTTAAAGGTGCAGTATGTAGGATTAACATCTAGGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link