ENSDARG00000079480

Ensembl ID:
ENSDARG00000079480
Mouse Orthologue:
Unc80
Mouse Description:
unc-80 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2652882]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20677 Nonsense Mutation detected in F1 DNA During 2016
sa38546 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110985 Nonsense 304 1298 7 24
Genomic Location:
Chromosome 6 (position 16643256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGAGAAGGGAGGCTCCTCACAGCAGGCTTTTGAGAAAGGATTTTCA[C/T]AACCAAGGAAGTGAGTCTTTTACCTCTAGGAACATACAAGTCCTGCTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110985 Nonsense 666 1298 13 24
Genomic Location:
Chromosome 6 (position 16584231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGGGCCCTTTATTCCATCCTCACCCATGACATCAGCTCTCGGATTTG[C/A]GATGTGTCACTGAACATCATCGATTGCCTCCTGCAGCTGGGTGTTGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link