LOC563762

Ensembl ID:
ENSDARG00000079479
Human Orthologue:
GPR4
Human Description:
G protein-coupled receptor 4 [Source:HGNC Symbol;Acc:4497]
Mouse Orthologue:
Gpr4
Mouse Description:
G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24988 Nonsense Mutation detected in F1 DNA During 2014
sa22663 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112925 Nonsense 78 373 1 1
Genomic Location:
Chromosome 15 (position 28172953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTACTTGATGAACCTCTCGATAGCAGACCTCTTGTATATTACCACTT[T/A]ACCACTTTGGATAGACTATTTTGTCCACCATGATAACTGGATCCATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112925 Nonsense 180 373 1 1
Genomic Location:
Chromosome 15 (position 28172646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAACTCTTCCAGGACCGATTCAACCACACCTTCTGCTTCGAGAAGTA[T/A]CCTATGGAGCCCTGGGTTGCTGGAATGAACCTTTACCGCACTTTCCTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xcbcmlim