fam125bb

Ensembl ID:
ENSDARG00000079478
ZFIN ID:
ZDB-GENE-080414-2
Description:
family with sequence similarity 125, member B [Source:RefSeq peptide;Acc:NP_001129949]
Human Orthologue:
FAM125B
Human Description:
family with sequence similarity 125, member B [Source:HGNC Symbol;Acc:23368]
Mouse Orthologue:
Fam125b
Mouse Description:
family with sequence similarity 125, member B Gene [Source:MGI Symbol;Acc:MGI:1919793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11811 Nonsense Available for shipment Available now
sa21338 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Nonsense 157 273 5 9
ENSDART00000138921 Nonsense 176 292 6 10
Genomic Location:
Chromosome 8 (position 34369263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATATACATATTTATTTTCCACAGAGAGCTGAATGGTTTGGGGATTTG[G/A]TACCAGCTGGGAAAAGTCCCTAAGTCGCAKGACACAACACAGAAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Essential Splice Site 215 273 6 9
ENSDART00000138921 Essential Splice Site 234 292 7 10
Genomic Location:
Chromosome 8 (position 34325744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGTCAAGCCAGATTATGACGAAATCTACAACATCTACACCAAATCAG[G/A]TCAGTCCTTTTTTAAATATGACTAAACATTAGCTTATCAGCAATTGCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f8v6xady