B0JZN2_DANRE

Ensembl ID:
ENSDARG00000079475
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B0JZN2]
Human Orthologue:
NCKIPSD
Human Description:
NCK interacting protein with SH3 domain [Source:HGNC Symbol;Acc:15486]
Mouse Orthologue:
Nckipsd
Mouse Description:
NCK interacting protein with SH3 domain Gene [Source:MGI Symbol;Acc:MGI:1931834]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1070 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1070
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114777 Nonsense 640 782 10 12
Genomic Location (Zv9):
Chromosome 22 (position 212093)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 128599
KASP Assay ID:
554-0972.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTTTCTGCAGTGCCGGACAGTAATATAGTGATG[C/T]AGACGCTGATGAAGAGGGACAACGCCAAGATCCTGAGTGAGAAACTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link