si:ch211-80m8.2

Ensembl ID:
ENSDARG00000079474
ZFIN ID:
ZDB-GENE-091204-270
Human Orthologue:
C11orf61
Human Description:
chromosome 11 open reading frame 61 [Source:HGNC Symbol;Acc:26266]
Mouse Orthologue:
BC024479
Mouse Description:
cDNA sequence BC024479 Gene [Source:MGI Symbol;Acc:MGI:2384579]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34935 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110056 Nonsense 342 539 4 4
ENSDART00000145965 Nonsense 341 403 4 4
Genomic Location (Zv9):
Chromosome 10 (position 32587269)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31688618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACTTCAACCCAGAGAAAGCCGAGGGAAGGGTCATCATGACAAAAGTG[C/T]AGAAGATGAACTGGAAAAACGTATATTATAAATTCCTGGACATCACTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link