si:ch211-120p12.3

Ensembl ID:
ENSDARG00000079473
ZFIN ID:
ZDB-GENE-090312-24
Description:
Novel protein similar to vertebrate mixed lineage kinase 4 (KIAA1804) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
RP5-862P8.2
Human Description:
Mitogen-activated protein kinase kinase kinase MLK4 [Source:UniProtKB/Swiss-Prot;Acc:Q5TCX8]
Mouse Orthologue:
BC021891
Mouse Description:
cDNA sequence BC021891 Gene [Source:MGI Symbol;Acc:MGI:2385307]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38936 Nonsense Mutation detected in F1 DNA During 2017
sa42194 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31928 Nonsense Available for shipment Available now
sa31927 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110070 Nonsense 521 1017 6 11
ENSDART00000144282 Nonsense 498 959 6 10
Genomic Location (Zv9):
Chromosome 13 (position 23869446)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23515106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGCACAAAATCACAGTTCAGGCCTCTCCTACGATGGACAAGAGA[C/T]GAAGTCTCAATAGCACAAACTCAAGCCCTCCCAGCAGCCCGACTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110070 Essential Splice Site 544 1017 6 11
ENSDART00000144282 Essential Splice Site 521 959 6 10
Genomic Location (Zv9):
Chromosome 13 (position 23869373)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23515033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTCCCAGCAGCCCGACTCTGATCCCTCGCCTCCGTGCTATTCAAT[G/T]TGAGTACCCACTCTTCTACACTCTTTACCATTTTTTCATAACTGTATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110070 Nonsense 704 1017 10 11
ENSDART00000144282 Nonsense 646 959 9 10
Genomic Location (Zv9):
Chromosome 13 (position 23862808)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23508468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATCGATCTACCTCTGTGGAAAGATGAACCAGGCGAGAACCAGAGTT[C/A]AACAGGAGGAGGAGCTGAGAGCCAGGAGGACCCAACCACCTCCACCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110070 Nonsense 921 1017 11 11
ENSDART00000144282 Nonsense 863 959 10 10
Genomic Location (Zv9):
Chromosome 13 (position 23859231)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23504891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACCACTTCTACAAAGAAGAAGGCTGACAAAGAGCCTCCTCAAGACAAG[C/T]AGACCTCTGGGGAATCAGTATCTCGACCCAGACCGCTTTCCCTCAGAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link