ENSDARG00000079469

Ensembl ID:
ENSDARG00000079469
Human Orthologues:
AC008661.1, TRPC7
Human Descriptions:
short transient receptor potential channel 7 isoform 1 [Source:RefSeq peptide;Acc:NP_065122]
transient receptor potential cation channel, subfamily C, member 7 [Source:HGNC Symbol;Acc:20754]
Mouse Orthologue:
Trpc7
Mouse Description:
transient receptor potential cation channel, subfamily C, member 7 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35620 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114299 Nonsense 16 263 2 2
Genomic Location (Zv9):
Chromosome 14 (position 1417575)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1460443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTTGCTAATTGTTTCGTGTTCTCTCAGGTCAGAGGTCATGCATCGC[A/T]GACACACCACCCTGCGAGAGAAGGGTCGCCGGCAGGCCGTCCGCGGCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link