RHOBTB1

Ensembl ID:
ENSDARG00000079468
Description:
Rho-related BTB domain containing 1 [Source:HGNC Symbol;Acc:18738]
Human Orthologue:
RHOBTB1
Human Description:
Rho-related BTB domain containing 1 [Source:HGNC Symbol;Acc:18738]
Mouse Orthologue:
Rhobtb1
Mouse Description:
Rho-related BTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916538]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13147 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126661 Nonsense 211 687 4 9
Genomic Location:
Chromosome 12 (position 8681328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTATCTTTGATAACGCCATCCGAGCAGCTCTCATCTCCAGACGCCACCTA[C/T]AGTTYTGGAAGTCTCATCTGAGGCGAGTCCAAAAGCCTCTTCTGCAGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/stc4wssw