LOC100003570

Ensembl ID:
ENSDARG00000079463
Human Orthologue:
MAN2B2
Human Description:
mannosidase, alpha, class 2B, member 2 [Source:HGNC Symbol;Acc:29623]
Mouse Orthologue:
Man2b2
Mouse Description:
mannosidase 2, alpha B2 Gene [Source:MGI Symbol;Acc:MGI:1195262]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26924 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31563 Essential Splice Site Available for shipment Available now
sa34035 Nonsense Available for shipment Available now
sa17831 Nonsense Available for shipment Available now
sa31562 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114203 Essential Splice Site 91 1006 2 19
Genomic Location (Zv9):
Chromosome 7 (position 20683903)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19274339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCGACTCTGGTGGACGAATGTGGCATCAGATTGGCACAAGAAACAG[G/A]TGAGAGGACGTAATAGATTTATAGTTATTGTTTACCACGGTGGTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114203 Essential Splice Site 474 1006 9 19
Genomic Location (Zv9):
Chromosome 7 (position 20677720)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19268156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACATCTATGACCAAATCAAGAACACACCCACCACAGCCAGGACTGG[T/C]ATATGTCTTCATTGAGATTTTCTAAATCAGGGGTTTCTAACATGGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114203 Nonsense 588 1006 11 19
Genomic Location (Zv9):
Chromosome 7 (position 20676201)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19266637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAATAAAACAAATGTGAGACAGTGGAAGAAGACTGGTAGAAAGTTGT[T/A]ACCAGTTCTGAACGAGTGCTATAAACTGATGTTTGACCAAGAGACAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114203 Nonsense 595 1006 11 19
Genomic Location (Zv9):
Chromosome 7 (position 20676179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19266615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGAAGAAGACTGGTAGAAAGTTGTTACCAGTTCTGAACGAGTGCTA[T/A]AAAMTRATGTTTGACCAAGAGACAAATCTTCTGCAYAGYATCACAGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114203 Nonsense 1000 1006 19 19
Genomic Location (Zv9):
Chromosome 7 (position 20667663)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19258099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTGGTGTTACCCAAGACTTCAATGTGACCATTTCCCCAAAAGAAATC[A/T]GAACCTTCTTCATCTACTTTTAGTAAACAGTCTGGCAGCAGCCAGTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link