nlgn4a

Ensembl ID:
ENSDARG00000079455
ZFIN IDs:
ZDB-GENE-100309-2, ZDB-GENE-100309-2
Description:
neuroligin 4b [Source:RefSeq peptide;Acc:NP_001159803]
Human Orthologues:
NLGN4X, NLGN4Y
Human Descriptions:
neuroligin 4, X-linked [Source:HGNC Symbol;Acc:14287]
neuroligin 4, Y-linked [Source:HGNC Symbol;Acc:15529]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32702 Nonsense Mutation detected in F1 DNA During 2017
sa32703 Nonsense Mutation detected in F1 DNA During 2017
sa39634 Nonsense Mutation detected in F1 DNA During 2017
sa32704 Nonsense Mutation detected in F1 DNA During 2017
sa18031 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 351 826 4 5
ENSDART00000128317 Nonsense 368 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGCGTTTGGTCCAGTAATTGACGGTGACGTCATCCCAGATGACCCC[C/T]AAATTCTGATGGAGCAAGGGGAGTTCCTCAACTATGACATCATGCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 446 826 4 5
ENSDART00000128317 Nonsense 463 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221867)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGAGACCAGGCGAAAGACTCTAGTTGCACTTTTCACTGATCACCAATG[G/A]GTGGCGCCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 465 826 4 5
ENSDART00000128317 Nonsense 482 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221924)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCCAACATA[T/A]TTTTATGCTTTTTACCATCATTGTCAGAGTGAAATGAAACCTAGCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 605 826 5 5
ENSDART00000128317 Nonsense 622 843 6 6
Genomic Location (Zv9):
Chromosome 1 (position 32243683)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31958471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACTGGTACCTCATCTCCATAACATCAACGAACTCTTTCAGTATGTCT[C/A]GACCACTACAAAGATACCTCCTCAGGATACTACACCTTTCCCATACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 695 826 5 5
ENSDART00000128317 Nonsense 712 843 6 6
Genomic Location (Zv9):
Chromosome 1 (position 32243954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31958742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTTCTCTCCTTTTCCTCAACATTCTGGCATTYGCAGCGCTCTACTA[C/A]AAGAAGGAKAAACGTCGACATGAATCCAACCGACGAGGACCAAGCCCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link