NP_001108027.1

Ensembl ID:
ENSDARG00000079443
Description:
VIP peptides [Source:RefSeq peptide;Acc:NP_001108027]
Human Orthologue:
VIP
Human Description:
vasoactive intestinal peptide [Source:HGNC Symbol;Acc:12693]
Mouse Orthologue:
Vip
Mouse Description:
vasoactive intestinal polypeptide Gene [Source:MGI Symbol;Acc:MGI:98933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112468 Nonsense 48 151 3 6
Genomic Location (Zv9):
Chromosome 11 (position 44519258)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43114090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTATTWTCCAGACCCRGCGCTCTTGATGAAGACGGAGARGACGACTG[G/A]ACGAGRGATCCATCACTACAGGATCTGGAGGCGTATAAACTCCTGTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link