coro2ba

Ensembl ID:
ENSDARG00000079440
ZFIN ID:
ZDB-GENE-050518-1
Human Orthologue:
CORO2B
Human Description:
coronin, actin binding protein, 2B [Source:HGNC Symbol;Acc:2256]
Mouse Orthologue:
Coro2b
Mouse Description:
coronin, actin binding protein, 2B Gene [Source:MGI Symbol;Acc:MGI:2444283]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20987 Nonsense Available for shipment Available now
sa34108 Nonsense Mutation detected in F1 DNA During 2016
sa20988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 158 491 4 12
Genomic Location (Zv9):
Chromosome 7 (position 34663103)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33057443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCGAGTGGCATCCAACAACTAGCGGGATTCTCTTTAGTGCTGGCTA[T/A]GACTACAAGGTAAGGACAATTTGTGTGACACAATCTGATCAACTTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 160 491 4 12
Genomic Location (Zv9):
Chromosome 7 (position 34663109)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33057449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGCATCCAACAACTAGCGGGATTCTCTTTAGTGCTGGCTATGACTA[C/A]AAGGTAAGGACAATTTGTGTGACACAATCTGATCAACTTAAACTCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 410 491 11 12
Genomic Location (Zv9):
Chromosome 7 (position 34672533)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33066873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCATGTCCTTAAAAGAGGGCTACAACAGACCCAACAAGCTGGTGTTC[A/T]AAGCACCCGTGAAGGAGAAGAAGGGTGGAGTGGTCAATGGCATTGACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link