coro2ba

Ensembl ID:
ENSDARG00000079440
ZFIN ID:
ZDB-GENE-050518-1
Human Orthologue:
CORO2B
Human Description:
coronin, actin binding protein, 2B [Source:HGNC Symbol;Acc:2256]
Mouse Orthologue:
Coro2b
Mouse Description:
coronin, actin binding protein, 2B Gene [Source:MGI Symbol;Acc:MGI:2444283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20987 Nonsense Mutation detected in F1 DNA During 2014
sa20988 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 158 491 4 12
Genomic Location:
Chromosome 7 (position 34663103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCGAGTGGCATCCAACAACTAGCGGGATTCTCTTTAGTGCTGGCTA[T/A]GACTACAAGGTAAGGACAATTTGTGTGACACAATCTGATCAACTTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 410 491 11 12
Genomic Location:
Chromosome 7 (position 34672533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCATGTCCTTAAAAGAGGGCTACAACAGACCCAACAAGCTGGTGTTC[A/T]AAGCACCCGTGAAGGAGAAGAAGGGTGGAGTGGTCAATGGCATTGACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5d14bfsx