LOC100330353

Ensembl ID:
ENSDARG00000079438
Human Orthologue:
PKP3
Human Description:
plakophilin 3 [Source:HGNC Symbol;Acc:9025]
Mouse Orthologue:
Pkp3
Mouse Description:
plakophilin 3 Gene [Source:MGI Symbol;Acc:MGI:1891830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10467 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113744 Nonsense 148 688 1 13
Genomic Location:
Chromosome 7 (position 34298998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAYAATCGCCAGGTGCAGCAGCAACAGCATCAGAGGMTGAGCGGCAGTT[C/A]AATGCAGTGGCAGCAGATGTCCACTGGGGGCAACAGTCTGATGGGTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0li2u3bt