si:ch211-208h7.4

Ensembl ID:
ENSDARG00000079434
ZFIN ID:
ZDB-GENE-030131-6110
Human Orthologue:
KIAA0922
Human Description:
KIAA0922 [Source:HGNC Symbol;Acc:29146]
Mouse Orthologue:
D930015E06Rik
Mouse Description:
RIKEN cDNA D930015E06 gene Gene [Source:MGI Symbol;Acc:MGI:2443399]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10363 Essential Splice Site Available for shipment Available now
sa32680 Nonsense Mutation detected in F1 DNA During 2017
sa7366 Missense Mutation detected in F1 DNA During 2017
sa31205 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Essential Splice Site 354 1546 10 34
ENSDART00000133208 Essential Splice Site 353 1545 10 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24138638)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24590409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAGGAGTGTTCATGTTGAACTCAGGTGTTAAAAAGCTCTTTGTTAAGG[T/A]ATGTGCACGTACATTGACATTGTTTTAACGTTTTTAATTATGTATGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Nonsense 798 1546 22 34
ENSDART00000133208 Nonsense 797 1545 22 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24151701)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24603472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGGCGAGTTGCCGCTGACTGTAGTGTCCATGAACATTAATGGATAT[A/T]AATGTCAGGGTTATGGTTTTGAAGTGCAGCACTGTGGATCCTTCAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Missense 1313 1546 30 34
ENSDART00000133208 Missense 1312 1545 30 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24168299)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24620070
KASP Assay ID:
554-4196.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAGAGAACCATACCAAAGCTCAGAAATGGGTCCWGTCCCAGCACTTC[C/A]TCACACCTTCGCWGATGTAGCTGCAGGTGTGGACAAAAACATCGGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Essential Splice Site 1371 1546 31 34
ENSDART00000133208 Essential Splice Site 1370 1545 31 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24170541)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24622312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATCTCTCCCGTTTGTCCCTCAGAATCCCTCATCCAGATATGATGGG[T/C]ACGTCTCCAGCTTCTTTCTACTTATCTAGCATTTTTTTTTCTTCACATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link