NLRP6 (76 of 83)

Ensembl ID:
ENSDARG00000079433
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32798 Nonsense Mutation detected in F1 DNA During 2017
sa32799 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101900 Nonsense 252 920 2 6
Genomic Location (Zv9):
Chromosome 1 (position 58310460)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57233878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGAAACTTTTCCCTGACATCACTGGCGTGGAAAAGACACCGTTTTA[T/A]GAAAAATGCAAACTGCTGTTCATCTTTGATGGGCTTGATGAGAGTCGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101900 Nonsense 349 920 2 6
Genomic Location (Zv9):
Chromosome 1 (position 58310749)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57234167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACAAGCAGAAGGAGGAGTACTTCAGAAGAAAGGTCCCAGATGAAGAT[C/T]AAGCCTCCAGGATAATCTCCCACATCCGGACGTCCCGCAGTCTCTACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link