si:dkey-202m22.7

Ensembl ID:
ENSDARG00000079423
ZFIN ID:
ZDB-GENE-091118-42
Description:
G protein-coupled receptor 7 [Source:RefSeq peptide;Acc:NP_001124241]
Human Orthologue:
NPBWR2
Human Description:
neuropeptides B/W receptor 2 [Source:HGNC Symbol;Acc:4530]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24369 Nonsense Available for shipment Available now
sa6744 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033429 Nonsense 483 731 3 4
ENSDART00000112297   None 326 None 1
Genomic Location (Zv9):
Chromosome 23 (position 31080978)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30915868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCCTTCGGTCTGCCCCTGTGCAAGGCTGTGGTAGCCATTGACTATTA[C/A]AACATGTTCACAAGTGTCTTCACCTTGACCGTAATGAGTGTGGATCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033429 Nonsense 661 731 4 4
ENSDART00000112297   None 326 None 1
Genomic Location (Zv9):
Chromosome 23 (position 31084224)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30919114
KASP Assay ID:
554-5347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGGGGCCAGTCAGTCCTCRATGGCGGCTATGCATTTCTGCATTGCTT[T/A]GGGTTACGCAAACAGCTGTTTAAACCCCGTTCTCTATGCCTTCCTGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link