dpp4

Ensembl ID:
ENSDARG00000079420
ZFIN ID:
ZDB-GENE-081104-277
Description:
dipeptidyl-peptidase 4 [Source:RefSeq peptide;Acc:NP_001154809]
Human Orthologues:
DPP4, FAP
Human Descriptions:
dipeptidyl-peptidase 4 [Source:HGNC Symbol;Acc:3009]
fibroblast activation protein, alpha [Source:HGNC Symbol;Acc:3590]
Mouse Orthologues:
Dpp4, Fap
Mouse Descriptions:
dipeptidylpeptidase 4 Gene [Source:MGI Symbol;Acc:MGI:94919]
fibroblast activation protein Gene [Source:MGI Symbol;Acc:MGI:109608]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24096 Nonsense Available for shipment Available now
sa43788 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43787 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109596 Nonsense 130 742 6 26
Genomic Location (Zv9):
Chromosome 22 (position 11755014)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11615182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTTAACAGCTATGGAGACACACATACACTGCATCATATTCCATCTA[T/G]GACCTGGAAAAAAGGTTTGTTTACTAATGTATTTGATTAGGAATTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109596 Essential Splice Site 158 742 7 26
Genomic Location (Zv9):
Chromosome 22 (position 11754537)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11614705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGCACGATGTCCAGTACTTAGCATGGTCTCCAACTGGCCACAAACTGG[T/G]GAGTATCTTATCAGTACAATACGGTATCATGTAAGACTCATAAAACCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109596 Nonsense 285 742 11 26
Genomic Location (Zv9):
Chromosome 22 (position 11750798)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11610966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAATGATCTGACCGAACAGAAGGATCTGTTTTGTTCCAGAGAGCACTA[T/A]CTGAGCACTGTCACATGGGCGTCAGACCACCGAATCGCAGTGCAGTGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link