SEZ6 (1 of 2)

Ensembl ID:
ENSDARG00000079414
Description:
seizure related 6 homolog (mouse) [Source:HGNC Symbol;Acc:15955]
Human Orthologue:
SEZ6
Human Description:
seizure related 6 homolog (mouse) [Source:HGNC Symbol;Acc:15955]
Mouse Orthologue:
Sez6
Mouse Description:
seizure related gene 6 Gene [Source:MGI Symbol;Acc:MGI:104745]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42549 Nonsense Mutation detected in F1 DNA During 2017
sa39044 Nonsense Mutation detected in F1 DNA During 2017
sa11443 Nonsense Available for shipment Available now
sa42550 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111226 Nonsense 621 1028 9 19
Genomic Location (Zv9):
Chromosome 15 (position 23854114)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24565301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTGTTTGTTTGTATTGCAGCTGTTTGCAGTGGTGAGATCACAGATT[C/A]AGCTGGGATGGTCTTGTCTCCAAACTGGCCTGAGGCCTATGATAAGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111226 Nonsense 837 1028 12 19
Genomic Location (Zv9):
Chromosome 15 (position 23884059)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24595246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAACAAAGGCTACTCGCTGTCAGGAAACAGCCTCCTTTCTTGCTACCAC[A/T]GAGACTCCACTGGCCCCAAGTGGAGCGAGAAACTGCCCAAATGCATCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111226 Nonsense 846 1028 12 19
Genomic Location (Zv9):
Chromosome 15 (position 23884086)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24595273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCCWCCTTTCTTGCTACCACAGAGACTCCACTGGCCCCAAGTGGAGC[G/T]AGAAACTGCCCAAATGCATCCGTGAGTGACATTTACACACCTAGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111226 Essential Splice Site 931 1028 15 19
Genomic Location (Zv9):
Chromosome 15 (position 23886815)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24598002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTATGCAGATGAATTTGTATGTATTTGCTGTACTCTGTCCCCATTTA[G/A]TGGCCAGTGCAGACTTCAGTATGGAGGGGGCCAGTGTGGCTGTGTCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link