PPEF2

Ensembl ID:
ENSDARG00000079413
Description:
protein phosphatase, EF-hand calcium binding domain 2 [Source:HGNC Symbol;Acc:9244]
Human Orthologue:
PPEF2
Human Description:
protein phosphatase, EF-hand calcium binding domain 2 [Source:HGNC Symbol;Acc:9244]
Mouse Orthologue:
Ppef2
Mouse Description:
protein phosphatase, EF hand calcium-binding domain 2 Gene [Source:MGI Symbol;Acc:MGI:1342304]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20559 Nonsense Mutation detected in F1 DNA During 2017
sa20558 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108926 Nonsense 35 304 1 9
Genomic Location (Zv9):
Chromosome 5 (position 63802823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52274889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAATGAGACGAAGATACACTTGGAACATCTTCCAGTCCATGGAGTA[T/A]GCAGACCTACAAGACCAGATCAAAGTAAGAAATTGTTTACCTTAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108926 Essential Splice Site 293 304 8 9
Genomic Location (Zv9):
Chromosome 5 (position 63798635)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 52270702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGACAGCACAAACCTTGCTCTCATAGCTCGAGTTGACCGACATAGA[G/A]TAAGTCAAACAACCAGACTACATCAATAATTGCAGATTGAGATTTTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link