hoxc11b

Ensembl ID:
ENSDARG00000079406
ZFIN ID:
ZDB-GENE-000822-3
Description:
Homeobox c11b [Source:UniProtKB/TrEMBL;Acc:Q4PR81]
Human Orthologue:
HOXC11
Human Description:
homeobox C11 [Source:HGNC Symbol;Acc:5123]
Mouse Orthologue:
Hoxc11
Mouse Description:
homeobox C11 Gene [Source:MGI Symbol;Acc:MGI:96193]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35003 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111698 Nonsense 269 306 2 2
Genomic Location (Zv9):
Chromosome 11 (position 2171676)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2124129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTTCTTTAACGTTTACATCAACAAGGAGAAACGGCTTCAGCTCTCC[A/T]GAATATTAAACCTTACTGACCGACAGGTCAAAATTTGGTTTCAGAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link