tpsn

Ensembl ID:
ENSDARG00000079402
ZFIN ID:
ZDB-GENE-990714-21
Description:
tapasin [Source:RefSeq peptide;Acc:NP_571049]
Human Orthologue:
TAPBP
Human Description:
TAP binding protein (tapasin) [Source:HGNC Symbol;Acc:11566]
Mouse Orthologue:
Tapbp
Mouse Description:
TAP binding protein Gene [Source:MGI Symbol;Acc:MGI:1201689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36774 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066173 Nonsense 325 433 6 9
ENSDART00000104845 Nonsense 334 442 5 8

The following transcripts of ENSDARG00000079402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7662678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7121217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCCTCACACTCTGGATCTGGGCTGGGAGTTTACCGGGGCTGATGGG[A/T]AGTCCCTCTCTCTGGGTCAGGGCAGTGTAACGGGTCACAGACGGGCGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link