LOC793315

Ensembl ID:
ENSDARG00000079399
Human Orthologue:
F2RL3
Human Description:
coagulation factor II (thrombin) receptor-like 3 [Source:HGNC Symbol;Acc:3540]
Mouse Orthologue:
F2rl3
Mouse Description:
coagulation factor II (thrombin) receptor-like 3 Gene [Source:MGI Symbol;Acc:MGI:1298207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12331 Nonsense Available for shipment Available now
sa42429 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111674 Nonsense 293 373 2 2
Genomic Location (Zv9):
Chromosome 14 (position 38196708)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36535019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTCTTGTTGCCTAGCAATATTCTSATGCTGTGGCATTATTCTAAAT[C/A]AAGTTCGGTCAACAATCTTTATATGCCGTACCTGATYGCTTTGTCTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111674 Nonsense 300 373 2 2
Genomic Location (Zv9):
Chromosome 14 (position 38196730)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36535041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCATGCTGTGGCATTATTCTAAATCAAGTTCGGTCAACAATCTTTA[T/A]ATGCCGTACCTGATCGCTTTGTCTCTCAGCACATTCAACAGCTGCATCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link