sc:d0350

Ensembl ID:
ENSDARG00000079396
ZFIN ID:
ZDB-GENE-080327-20
Description:
cDNA, clone cssl:d0350 [Source:UniProtKB/TrEMBL;Acc:A8BB80]
Human Orthologue:
LRFN5
Human Description:
leucine rich repeat and fibronectin type III domain containing 5 [Source:HGNC Symbol;Acc:20360]
Mouse Orthologue:
Lrfn5
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:214

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110679 Nonsense 254 765 1 3
Genomic Location (Zv9):
Chromosome 20 (position 54737322)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54609189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGTTTYGGGGGTAATCCTCTGCACTGTAACTGCGAGCTGCTGTGGT[T/A]GCGGCGACTGCGGCGCGAGGACGATCTGGAGACCTGTGCGGCACCACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link