agrn

Ensembl ID:
ENSDARG00000079388
ZFIN ID:
ZDB-GENE-030131-1033
Description:
agrin [Source:RefSeq peptide;Acc:NP_001170923]
Human Orthologue:
AGRN
Human Description:
agrin [Source:HGNC Symbol;Acc:329]
Mouse Orthologue:
Agrn
Mouse Description:
agrin Gene [Source:MGI Symbol;Acc:MGI:87961]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15437 Essential Splice Site Available for shipment Available now
sa381 Splice Site Available for shipment Available now
sa5046 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25196 Nonsense Mutation detected in F1 DNA During 2014
sa11435 Essential Splice Site Available for shipment Available now
sa12413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Essential Splice Site 294 1787 4 32
ENSDART00000134993 Essential Splice Site 219 1712 3 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24063467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGCGCTCTTCAGAAACAGATACAGATGCAACACAAAGGACCATGTGG[T/G]AAGTCCAAACACAANNNNNNACACACACACACATGCATTGATGCCACTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Splice Site None 1787 None 32
ENSDART00000134993 Splice Site None 1712 None 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24103335)
KASP Assay ID:
554-0361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAAAATCTGTATGAAACCCAACAGCTGTATATGTGTGTGTGTTTTTC[A/C]TCAGACTGTGGTTCAGGAGGCTCCGGCTCGGGATCTGAGACTTGTGAACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Essential Splice Site 604 1787 10 32
ENSDART00000134993 Essential Splice Site 529 1712 9 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24117124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGGAACTTCCGTGGCATTGTCACAGAAAACATGAGCGGCTGCACAC[G/T]TAAGCATCACTCTCCTCTCCCTATCCCKGCAATRCATATATACAGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Nonsense 836 1787 14 32
ENSDART00000134993 Nonsense 761 1712 13 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24131697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCAGTGGGGATGATGAGATGGTGAGCGGAATGGAGGAGAGCGGAGAA[G/T]AGCCACTTGGTAATGCATTCACCATAATCTTTTAGTTATAAGAGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Essential Splice Site 1597 1787 28 32
ENSDART00000134993 Essential Splice Site 1522 1712 27 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24177898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAGTGCGCCTGCCGCCAYGGATTCTCCGGACACCACTGCCAGGACAG[T/A]AAGTTCCTTATTTAATCACTTTTTAAAAATCATATTACCCAATATAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465 None None 156 None 3
ENSDART00000114067 Nonsense 1694 1787 30 32
ENSDART00000134993 Nonsense 1619 1712 29 31
ENSDART00000147313 None None 156 None 2
Genomic Location:
Chromosome 23 (position 24190320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAGCCTGTGGTGCTGCGCTCCACTGTACGGGTCAACACCAACCACTG[G/A]ATACGAATTAAGGCCAGCAGGTAAAATGCTAAAAAKCWTTTCCAGYATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cz46hb15