agrn

Ensembl ID:
ENSDARG00000079388
ZFIN ID:
ZDB-GENE-030131-1033
Description:
agrin [Source:RefSeq peptide;Acc:NP_001170923]
Human Orthologue:
AGRN
Human Description:
agrin [Source:HGNC Symbol;Acc:329]
Mouse Orthologue:
Agrn
Mouse Description:
agrin Gene [Source:MGI Symbol;Acc:MGI:87961]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15437 Essential Splice Site Available for shipment Available now
sa381 Splice Site Available for shipment Available now
sa29921 Nonsense Mutation detected in F1 DNA During 2016
sa43979 Nonsense Mutation detected in F1 DNA During 2016
sa43980 Nonsense Mutation detected in F1 DNA During 2016
sa25196 Nonsense Mutation detected in F1 DNA During 2016
sa11435 Essential Splice Site Available for shipment Available now
sa12413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Essential Splice Site 294 1787 4 32
ENSDART00000134993 Essential Splice Site 219 1712 3 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24063467)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23850033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGCGCTCTTCAGAAACAGATACAGATGCAACACAAAGGACCATGTGG[T/G]AAGTCCAAACACAANNNNNNACACACACACACATGCATTGATGCCACTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Splice Site None 1787 None 32
ENSDART00000134993 Splice Site None 1712 None 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24103335)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23889901
KASP Assay ID:
554-0361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAAAATCTGTATGAAACCCAACAGCTGTATATGTGTGTGTGTTTTTC[A/C]TCAGACTGTGGTTCAGGAGGCTCCGGCTCGGGATCTGAGACTTGTGAACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa29921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Nonsense 560 1787 10 32
ENSDART00000134993 Nonsense 485 1712 9 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24116990)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23903556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACTTTTTTTTTACAGGTATGTGTCAGTGCAATCATTACGGCTCATA[C/A]GGAGGCACATGTGACCCCTCGACTGGCCAGTGTTCCTGTAAACCTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Nonsense 727 1787 13 32
ENSDART00000134993 Nonsense 652 1712 12 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24120720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23907286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCATCGCATGCCGACAAGATAAAGAGATCAAGGTGGAGCATTTAGGC[C/T]AGTGTAAAGGTGAGATTAGTCTGATGTACTCGGATTGGTTAAGTCATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Nonsense 759 1787 14 32
ENSDART00000134993 Nonsense 684 1712 13 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24131466)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23918032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCACCCACCGCACCACCCCTCCCACCGCTCACGTCAAGGTCACCAAA[C/T]AGCGACATGGCCACCGCACCACCACTCCGGACAGCTATGTGGTGGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Nonsense 836 1787 14 32
ENSDART00000134993 Nonsense 761 1712 13 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24131697)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23918263
KASP Assay ID:
554-7801.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCAGTGGGGATGATGAGATGGTGAGCGGAATGGAGGAGAGCGGAGAA[G/T]AGCCACTTGGTAATGCATTCACCATAATCTTTTAGTTATAAGAGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Essential Splice Site 1597 1787 28 32
ENSDART00000134993 Essential Splice Site 1522 1712 27 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24177898)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23964464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAGTGCGCCTGCCGCCAYGGATTCTCCGGACACCACTGCCAGGACAG[T/A]AAGTTCCTTATTTAATCACTTTTTAAAAATCATATTACCCAATATAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111465   None 156 None 3
ENSDART00000114067 Nonsense 1694 1787 30 32
ENSDART00000134993 Nonsense 1619 1712 29 31
ENSDART00000147313   None 156 None 2
Genomic Location (Zv9):
Chromosome 23 (position 24190320)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23976886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAGCCTGTGGTGCTGCGCTCCACTGTACGGGTCAACACCAACCACTG[G/A]ATACGAATTAAGGCCAGCAGGTAAAATGCTAAAAAKCWTTTCCAGYATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link