ENSDARG00000079385

Ensembl ID:
ENSDARG00000079385
Human Orthologue:
CCDC64B
Human Description:
coiled-coil domain containing 64B [Source:HGNC Symbol;Acc:33584]
Mouse Orthologue:
Ccdc64b
Mouse Description:
coiled-coil domain containing 64B Gene [Source:MGI Symbol;Acc:MGI:2388267]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14537 Nonsense Available for shipment Available now
sa11485 Nonsense Available for shipment Available now
sa8887 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108856 Nonsense 175 484 3 9
Genomic Location:
Chromosome 15 (position 2708220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAAGCAGGAAATGAGAGAAAGAGGACAGGCCAGACCTCAAGATGAA[G/T]AGATGATYAATGCTCTTAGAGAACAGGTGGGAAACATGTNNNNNGCTTGCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108856 Nonsense 410 484 8 9
ENSDART00000108856 Nonsense 410 484 8 9
Genomic Location:
Chromosome 15 (position 2696816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGATGTGCTTAAACAACCAACTCCTRGAAGCCATCCAGCGAAAACTT[G/T]AGCTCTCGCAGGAACTCGAAGCCTGGAAGGTACAAATCTGTTATGTSRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108856 Nonsense 410 484 8 9
ENSDART00000108856 Nonsense 410 484 8 9
Genomic Location:
Chromosome 15 (position 2696816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGATGTGCTTAAACAACCAACTCCTRGAAGCCATCCAGCGAAAACTT[G/T]AGCTCTCGCAGGAACTCGAAGCCTGGAAGGTACAAATCTGTTATGTSRTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2as8th2h