HDX

Ensembl ID:
ENSDARG00000079382
Description:
highly divergent homeobox [Source:HGNC Symbol;Acc:26411]
Human Orthologue:
HDX
Human Description:
highly divergent homeobox [Source:HGNC Symbol;Acc:26411]
Mouse Orthologue:
Hdx
Mouse Description:
highly divergent homeobox Gene [Source:MGI Symbol;Acc:MGI:2685226]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111681 Nonsense 326 649 4 13
Genomic Location:
Chromosome 14 (position 6223768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGGATGCAAAACCAGCAGCTTCTTGCWGAACAGATCAKCGTCCCCTA[T/A]YAGCTTACCATTAAAACTGATCTCCCAGGCATCGTCCAGAATTCCCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sq7ohmnj