PHLDB1 (1 of 2)

Ensembl ID:
ENSDARG00000079378
Description:
pleckstrin homology-like domain, family B, member 1 [Source:HGNC Symbol;Acc:23697]
Human Orthologue:
PHLDB1
Human Description:
pleckstrin homology-like domain, family B, member 1 [Source:HGNC Symbol;Acc:23697]
Mouse Orthologue:
Phldb1
Mouse Description:
pleckstrin homology-like domain, family B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2143230]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5878 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113142 Nonsense 915 1433 10 21
Genomic Location (Zv9):
Chromosome 15 (position 16930108)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18050481
KASP Assay ID:
554-3850.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCCAGCTACATAACTGCCCTGAGTCTCTGAGGGAACAGTTACAGGAA[C/T]AGCTCAAGAGGGTCAGTGAYCATCAGGACCATCAGCATTTATAAAGCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link