si:ch211-216c6.3

Ensembl ID:
ENSDARG00000079377
ZFIN ID:
ZDB-GENE-090313-83
Human Orthologue:
ARHGEF38
Human Description:
Rho guanine nucleotide exchange factor (GEF) 38 [Source:HGNC Symbol;Acc:25968]
Mouse Orthologue:
D630013G24Rik
Mouse Description:
RIKEN cDNA D630013G24 gene Gene [Source:MGI Symbol;Acc:MGI:2442801]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19507 Nonsense Available for shipment Available now
sa6590 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112263 Nonsense 162 811 5 21
ENSDART00000140612   None 171 None 4
ENSDART00000146412   None 225 None 4
Genomic Location (Zv9):
Chromosome 1 (position 25306251)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25729949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTATTTAGAGGGAAGCCTAATTTGCTTGACATGGGTTCTCTACTCATT[A/T]AACCAGTCCAGCGCATCATGAAATACCCACTTCTATTGGCTGAACTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112263 Nonsense 178 811 5 21
ENSDART00000140612   None 171 None 4
ENSDART00000146412   None 225 None 4
Genomic Location (Zv9):
Chromosome 1 (position 25306301)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25729999
KASP Assay ID:
554-4829.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCAGTCCAGCGCATCATGAAATACCCACTTCTATTGGCTGAACTGTG[G/A]AATGCGACACCCACAGATCACCCTGACCACAGGCCTTTACAGGAAGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link