si:ch211-264f5.6

Ensembl ID:
ENSDARG00000079372
ZFIN ID:
ZDB-GENE-081104-208
Human Orthologues:
CEACAM1, CEACAM16, CEACAM18, CEACAM21, CEACAM3, CEACAM4, CEACAM5, CEACAM6, CEACAM7, CEACAM8, PSG1, PSG11, PSG2, PSG3, PSG4, PSG5, PSG6, PSG8, PSG9
Human Descriptions:
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) [Source:HGNC Symbol
carcinoembryonic antigen-related cell adhesion molecule 16 [Source:HGNC Symbol;Acc:31948]
carcinoembryonic antigen-related cell adhesion molecule 18 [Source:HGNC Symbol;Acc:31949]
carcinoembryonic antigen-related cell adhesion molecule 21 [Source:HGNC Symbol;Acc:28834]
carcinoembryonic antigen-related cell adhesion molecule 3 [Source:HGNC Symbol;Acc:1815]
carcinoembryonic antigen-related cell adhesion molecule 4 [Source:HGNC Symbol;Acc:1816]
carcinoembryonic antigen-related cell adhesion molecule 5 [Source:HGNC Symbol;Acc:1817]
carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) [Sou
carcinoembryonic antigen-related cell adhesion molecule 7 [Source:HGNC Symbol;Acc:1819]
carcinoembryonic antigen-related cell adhesion molecule 8 [Source:HGNC Symbol;Acc:1820]
pregnancy specific beta-1-glycoprotein 1 [Source:HGNC Symbol;Acc:9514]
pregnancy specific beta-1-glycoprotein 11 [Source:HGNC Symbol;Acc:9516]
pregnancy specific beta-1-glycoprotein 2 [Source:HGNC Symbol;Acc:9519]
pregnancy specific beta-1-glycoprotein 3 [Source:HGNC Symbol;Acc:9520]
pregnancy specific beta-1-glycoprotein 4 [Source:HGNC Symbol;Acc:9521]
pregnancy specific beta-1-glycoprotein 5 [Source:HGNC Symbol;Acc:9522]
pregnancy specific beta-1-glycoprotein 6 [Source:HGNC Symbol;Acc:9523]
pregnancy specific beta-1-glycoprotein 8 [Source:HGNC Symbol;Acc:9525]
pregnancy specific beta-1-glycoprotein 9 [Source:HGNC Symbol;Acc:9526]
Mouse Orthologues:
AC138311.3, Ceacam1, Ceacam10, Ceacam11, Ceacam12, Ceacam13, Ceacam14, Ceacam15, Ceacam16, Ceacam18, Ceacam2, Ceacam20, Ceacam3, Ceacam5, Ceacam9, Gm5155, Psg16, Psg17, Psg18, Psg19, Psg20, Psg21, Psg22, Psg23, Psg25, Psg26, Psg27, Psg28, Psg29
Mouse Descriptions:
carcinoembryonic antigen-related cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1347245]
carcinoembryonic antigen-related cell adhesion molecule 10 Gene [Source:MGI Symbol;Acc:MGI:1347248]
carcinoembryonic antigen-related cell adhesion molecule 11 Gene [Source:MGI Symbol;Acc:MGI:1914246]
carcinoembryonic antigen-related cell adhesion molecule 12 Gene [Source:MGI Symbol;Acc:MGI:1914565]
carcinoembryonic antigen-related cell adhesion molecule 13 Gene [Source:MGI Symbol;Acc:MGI:1917035]
carcinoembryonic antigen-related cell adhesion molecule 14 Gene [Source:MGI Symbol;Acc:MGI:1914334]
carcinoembryonic antigen-related cell adhesion molecule 15 Gene [Source:MGI Symbol;Acc:MGI:2141810]
carcinoembryonic antigen-related cell adhesion molecule 16 Gene [Source:MGI Symbol;Acc:MGI:2685615]
carcinoembryonic antigen-related cell adhesion molecule 18 Gene [Source:MGI Symbol;Acc:MGI:1919681]
carcinoembryonic antigen-related cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1347246]
carcinoembryonic antigen-related cell adhesion molecule 20 Gene [Source:MGI Symbol;Acc:MGI:1918851]
carcinoembryonic antigen-related cell adhesion molecule 3 Gene [Source:MGI Symbol;Acc:MGI:3646296]
carcinoembryonic antigen-related cell adhesion molecule 5 Gene [Source:MGI Symbol;Acc:MGI:1920500]
carcinoembryonic antigen-related cell adhesion molecule 9 Gene [Source:MGI Symbol;Acc:MGI:1347247]
predicted gene 5155 Gene [Source:MGI Symbol;Acc:MGI:3647191]
pregnancy specific glycoprotein 16 Gene [Source:MGI Symbol;Acc:MGI:1347249]
pregnancy specific glycoprotein 17 Gene [Source:MGI Symbol;Acc:MGI:1347250]
pregnancy specific glycoprotein 18 Gene [Source:MGI Symbol;Acc:MGI:1347251]
pregnancy specific glycoprotein 19 Gene [Source:MGI Symbol;Acc:MGI:1347252]
pregnancy specific glycoprotein pseudogene 1 (Psg-ps1), non-coding RNA [Source:RefSeq DNA;Acc:NR_002
pregnancy-specific glycoprotein 20 Gene [Source:MGI Symbol;Acc:MGI:1891352]
pregnancy-specific glycoprotein 21 Gene [Source:MGI Symbol;Acc:MGI:1891353]
pregnancy-specific glycoprotein 22 Gene [Source:MGI Symbol;Acc:MGI:1891354]
pregnancy-specific glycoprotein 23 Gene [Source:MGI Symbol;Acc:MGI:1891355]
pregnancy-specific glycoprotein 25 Gene [Source:MGI Symbol;Acc:MGI:1891357]
pregnancy-specific glycoprotein 26 Gene [Source:MGI Symbol;Acc:MGI:1891358]
pregnancy-specific glycoprotein 27 Gene [Source:MGI Symbol;Acc:MGI:1891359]
pregnancy-specific glycoprotein 28 Gene [Source:MGI Symbol;Acc:MGI:1891360]
pregnancy-specific glycoprotein 29 Gene [Source:MGI Symbol;Acc:MGI:1891361]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23429 Nonsense Available for shipment Available now
sa12423 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114539 Nonsense 24 337 1 6
ENSDART00000133106 Nonsense 127 540 3 10

The following transcripts of ENSDARG00000079372 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 6387966)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5846821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTATAGTCACTAACAATGGAGACCTGGTGACTGGACAGATTGATCTT[G/T]AGGTTCTTGGTAAGTAAATTGCATTCGTTACTGGATAATTAAGTCTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114539 Essential Splice Site 27 337 None 6
ENSDART00000133106 Essential Splice Site 130 540 None 10

The following transcripts of ENSDARG00000079372 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 6387955)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5846810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTARCARTGGAGACCWGGTGACTGGACAGATTGATCTTGAGGTTCTTGG[T/G]AAGTAARTTGCATTCGTTACTGGATAATTAAGTCTTGAACAAACTTCTTR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link