A8WGD4_DANRE

Ensembl ID:
ENSDARG00000079368
Description:
LOC557209 protein [Source:UniProtKB/TrEMBL;Acc:A8WGD4]
Human Orthologue:
CLDN18
Human Description:
claudin 18 [Source:HGNC Symbol;Acc:2039]
Mouse Orthologue:
Cldn18
Mouse Description:
claudin 18 Gene [Source:MGI Symbol;Acc:MGI:1929209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5133 Nonsense Mutation detected in F1 DNA During 2014
sa15304 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113210 Nonsense 2 260 1 5
Genomic Location:
Chromosome 2 (position 22977992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCMACACTKGACACCAGCAGATCTTCAGCAAGGAACACACAGAACAAAC[A/T]GAATGAGTGCCCCAGCTCTGCAGACCACAGGCTTCGTTTCAGGCRTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113210 Essential Splice Site 215 260 5 5
Genomic Location:
Chromosome 2 (position 22980821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAAGAATTTCCTAGTTTTCAAACTAACTGTTGTACTGTTTYATTATT[A/T]GCAAAACCGAGACGAGAGAGGGCTACATCTACAWTGCAGCTCAGTGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f1h5lsig